Electrical and Lighting Maintenance
Molex-Polymicro Capillary 15UMx363UM 25M Reel
TSP015375 Flexible Fused Silica Capillary Tubing with Polyimide Coating: 15um ID x 363um OD, spool length of 25m.
Molex-Polymicro Capillary 50UMx363UM 25M Reel
TSP050375 Flexible Fused Silica Capillary Tubing with Polyimide Coating: 50um ID x 363um OD, spool length of 25m.
Molex-Polymicro Capillary 250UMx360UM 25M Reel
TSP250350 Flexible Fused Silica Capillary Tubing with Polyimide Coating: 250um ID x 360um OD, spool length of 25m.
Molex-Polymicro Capillary 180UMx360UM 25M Reel
TSP180350 Flexible Fused Silica Capillary Tubing with Polyimide Coating: 180um ID x 360um OD, spool length of 25m.
Molex-Polymicro Capillary 40UMx150UM 25M Reel
TSP040150 Flexible Fused Silica Capillary Tubing with Polyimide Coating: 40um ID x 150um OD, spool length of 25m.
Molex-Polymicro Capillary 100UMx164UM 25M Reel
TSP100170 Flexible Fused Silica Capillary Tubing with Polyimide Coating: 100um ID x 164um OD, spool length of 25m.
Cole-Parmer Wiremold/Legrand UL207BC Standard 6-Outlet Power Strip with 6 Ft Cord
Each model features an aluminum housing and impact-resistant plastic end caps. All outlet strips meet UL standard 1363 and have a built-in circuit breaker. Standard outlet strips are ideal for any general-purpose indoor use. Mounting clips are included for easy installation. Units have a combination ON/OFF switch/pilot light. CSA-approved.
THORLABS INC RG-58 BNC Coaxial Cable, BNC Male to BNC Male, 36" (914 mm)
RG-58 BNC Coaxial Cable, BNC Male to BNC Male, 36" (914 mm)
New England Biolabs, Inc. Control LAMP Primer Mix (rActin) - 50 rxns
The Control LAMP Primer Mix (rActin) targets actin RNA at an exon-exon junction. It is a LAMP primer set (F3 B3 FIP BIP LF LB) that amplifies rActin to ensure the absence of inhibition from human nucleic acid templates in a LAMP reaction. Control LAMP Primer Sequences rActin (5 3) rActin Primer Set Sequence ACTB-F3 AGTACCCCATCGAGCACG ACTB-B3 AGCCTGGATAGCAACGTACA ACTB-FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA ACTB-BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC ACTB-LF TGTGGTGCCAGATTTTCTCCA ACTB-LB CGAGAAGATGACCCAGATCATGT
Med Vet International Unisex Lab Coat, Staff Length, Poplin, 3 Pockets, White, Size 40, Each
Staff Length Lab Coat: In an easy care, 80% polyester/20% cotton poplin fabric that's designed to resist wrinkles. Button-front styling with two lower pockets, one chest pocket (with pencil slot) and side vent openings for easy access to pants pockets. 39" length. White, Size 40.
VWR International HALOGEN LAMP F/ V-1200,UV-1600
Halogen lamp for V-1200, UV-1600PC, UV-3100PC, V-3000PC
Cole-Parmer Fluke 115 Digital Multimeter with True-RMS
This compact meter features True-RMS AC and DC voltage, 6000-count resolution, min/max/average recording capabilities, frequency, auto/manual ranging, resistance, continuity/diode test, capacitance, display hold, white LED backlit display, and accuracies of ±0.5%. It's ideal use is for general electrical, HVAC, utility, and field service applications.